ANGPTL2 cloning plasmid

SKU: 2234567821 Категории:

1048.00BGN

  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atgaggccactgtgcgtgacatgctggtggctcggactgctggctgccatgggagctgttgcaggccaggaggacggttttgagggcactgaggagggctcgccaagagagttcatttacctaaacaggtacaagcgggcgggcgagtcccaggacaagtgcacctacaccttcattgtgccccagcagcgggtcacgggtgccatctgcgtcaactccaaggagcctgaggtgcttctggagaaccgagtgcataagcaggagctagagctgctcaacaatgagctgctcaagcagaagcggcagatcgagacgctgcagcagctggtggaggtggacggcggcattgtgagcgaggtgaagctgctgcgcaaggagagccgcaacatgaactcgcgggtcacgcagctctacatgcagctcctgcacgagatcatccgcaagcgggacaacgcgttggagctctcccagctggagaacaggatcctgaaccagacagccgacatgctgcagctggccagcaagtacaaggacctggagcacaagtaccagcacctggccacactggcccacaaccaatcagagatcatcgcgcagcttgaggagcactgccagagggtgccctcggccaggcccgtcccccagccaccccccgctgccccgccccgggtctaccaaccacccacctacaaccgcatcatcaaccagatctctaccaacgagatccagagtgaccagaacctgaaggtgctgccaccccctctgcccactatgcccactctcaccagcctcccatcttccaccgacaagccgtcgggcccatggagagactgcctgcaggccctggaggatggccacgacaccagctccatctacctggtgaagccggagaacaccaaccgcctcatgcaggtgtggtgcgaccagagacacgaccccgggggctggaccgtcatccagagacgcctggatggctctgttaacttcttcaggaactgggagacgtacaagcaagggtttgggaacattgacggcgaatactggctgggcctggagaacatttactggctgacgaaccaaggcaactacaaactcctggtgaccatggaggactggtccggccgcaaagtctttgcagaatacgccagtttccgcctggaacctgagagcgagtattataagctgcggctggggcgctaccatggcaatgcgggtgactcctttacatggcacaacggcaagcagttcaccaccctggacagagatcatgatgtctacacaggaaactgtgcccactaccagaagggaggctggtggtataacgcctgtgcccactccaacctcaacggggtctggtaccgcgggggccattaccggagccgctaccaggacggagtctactgggctgagttccgaggaggctcttactcactcaagaaagtggtgatgatgatccgaccgaaccccaacaccttccactaa


Description

A cloning plasmid for the ANGPTL2 gene.

Contact Form

    Ако желаете да получите оферта или имате въпроси за този продукт, моля копирайте линка или каталожния номер когато изпращате запитване.
    Ако имате някакви въпроси, моля да се свържете с Гентауър.
    За да се срържете с нас:
    Телефон: +359 89 745 53 88
    Имейл: [email protected]

    Related Products:

    Id Title / Description Supplier Size Price
    20-abx973659

    Mouse ANGPTL2 shRNA Plasmid

    Abbexa 150 µg, 300 µg 1602.00 BGN, 2242.00 BGN
    20-abx958279

    Human ANGPTL2 shRNA Plasmid

    Abbexa 150 µg, 300 µg 1602.00 BGN, 2242.00 BGN
    CSB-CL890768HU-10ug

    PSMD13 cloning plasmid

    Cusabio 10ug 466.00 BGN
    CSB-CL890769HU-10ug

    ST3GAL5 cloning plasmid

    Cusabio 10ug 466.00 BGN
    CSB-CL891544HU1-10ug

    INTU cloning plasmid

    Cusabio 10ug 466.00 BGN
    HomeCategoriesWishlistAccount
    Search
    1