PACSIN2 cloning plasmid

SKU: 2234567821 Категории:

466.00BGN

  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1461
  • Sequence: atgtctgtcacatatgatgattccgttggagtagaagtgtccagcgacagcttctgggaggtcgggaactacaagcggactgtgaagcggatcgacgatggccaccgcctgtgcagcgacctcatgaactgcctgcatgagcgggcgcgcatcgagaaggcgtatgcgcagcagctcactgagtgggcccggcgctggaggcagctcgtggagaaagggccccagtacgggaccgtggagaaggcctggatggccttcatgtccgaggcagagagggtgagcgagctgcacctcgaggtgaaggcctcactgatgaacgatgacttcgagaagatcaagaactggcagaaggaagcctttcacaagcagatgatgggcggcttcaaggagaccaaggaagctgaggacggctttcggaaggcacagaagccctgggccaagaagctgaaagaggtagaagcagcaaagaaagcccaccatgcagcgtgcaaagaggagaagctggctatctcacgagaagccaacagcaaggcagacccatccctcaaccctgaacagctcaagaaattgcaagacaaaatagaaaagtgcaagcaagatgttcttaagaccaaagagaagtatgagaagtccctgaaggaactcgaccagggcacaccccagtacatggagaacatggagcaggtgtttgagcagtgccagcagttcgaggagaaacgccttcgcttcttccgggaggttctgctggaggttcagaagcacctagacctgtccaatgtggctggctacaaagccatttaccatgacctggagcagagcatcagagcagctgatgcagtggaggacctgaggtggttccgagccaatcacgggccgggcatggccatgaactggccgcagtttgaggagtggtccgcagacctgaatcgaaccctcagccggagagagaagaagaaggccactgacggcgtcaccctgacgggcatcaaccagacaggcgaccagtctctgccgagtaagcccagcagcacccttaatgtcccgagcaaccccgcccagtctgcgcagtcacagtccagctacaaccccttcgaggatgaggacgacacgggcagcaccgtcagtgagaaggacgacactaaggccaaaaatgtgagcagctacgagaagacccagagctatcccaccgactggtcagacgatgagtctaacaaccccttctcctccacggatgccaatggggactcgaatccattcgacgacgacgccacctcggggacggaagtgcgagtccgggccctgtatgactatgaggggcaggagcatgatgagctgagcttcaaggctggggatgagctgaccaagatggaggacgaggatgagcagggctggtgcaagggacgcttggacaacgggcaagttggcctatacccggcaaattatgtggaggcgatccagtga


Description

A cloning plasmid for the PACSIN2 gene.

Contact Form

    Ако желаете да получите оферта или имате въпроси за този продукт, моля копирайте линка или каталожния номер когато изпращате запитване.
    Ако имате някакви въпроси, моля да се свържете с Гентауър.
    За да се срържете с нас:
    Телефон: +359 89 745 53 88
    Имейл: [email protected]

    Related Products:

    Id Title / Description Supplier Size Price
    20-abx973584

    Mouse PACSIN2 shRNA Plasmid

    Abbexa 150 µg, 300 µg 1602.00 BGN, 2242.00 BGN
    20-abx987489

    Rat PACSIN2 shRNA Plasmid

    Abbexa 150 µg, 300 µg 1602.00 BGN, 2242.00 BGN
    CSB-CL890763HU-10ug

    PCDHA6 cloning plasmid

    Cusabio 10ug 1818.00 BGN
    CSB-CL890766HU-10ug

    SNX6 cloning plasmid

    Cusabio 10ug 466.00 BGN
    CSB-CL891538HU-10ug

    FBXO4 cloning plasmid

    Cusabio 10ug 466.00 BGN
    HomeCategoriesWishlistAccount
    Search
    1