CSB-CL017603HU-10ug

PCF11 cloning plasmid

3638 BGN
Размер: 10ug
Oписание: A cloning plasmid for the PCF11 gene.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4668
  • Sequence: ATGTCAGAGCAGACGCCGGCCGAGGCCGGTGCTGCGGGGGCCCGGGAGGACGCCTGTCGGGATTATCAGTCATCGCTCGAAGACCTGACCTTCAATAGCAAGCCGCACATCAATATGCTGACCATTCTAGCCGAGGAGAACCTGCCCTTCGCCAAGGAGATCGTCTCTCTCATCGAGGCCCAAACCGCCAAGGCTCCTTCCTCAGAGAAGCTTCCTGTTATGTACCTTATGGATTCTATTGTGAAAAACGTTGGAAGAGAGTATCTCACTGCCTTTACTAAAAATCTAGTTGCAACATTTATTTGTGTGTTTGAAAAGGTGGATGAAAATACTAGGAAAAGTTTATTTAAGTTACGTTCTACATGGGATGAAATATTCCCTTTGAAGAAACTTTATGCCCTGGATGTCAGAGTCAATTCATTAGATCCTGCTTGGCCTATTAAACCTCTACCCCCCAATGTGAATACGTCTAGCATCCATGTGAATCCTAAATTTTTAAATAAATCGCCCGAGGAGCCTTCAACACCTGGTACAGTGGTCAGTTCCCCTAGCATCTCCACTCCTCCAATTGTTCCTGATATACAAAAGAATCTTACACAAGAACAACTAATAAGGCAGCAGTTACTGGCAAAGCAAAAACAGTTGTTAGAACTTCAGCAGAAAAAGCTGGAGCTTGAGCTAGAGCAAGCTAAGGCACAGTTGGCAGTTTCTCTTAGTGTTCAGCAGGAAACATCCAATTTAGGTCCTGGATCTGCACCATCCAAATTACATGTTTCACAGATTCCCCCTATGGCAGTTAAAGCTCCTCATCAGGTTCCTGTGCAATCTGAGAAAAGCCGTCCAGGACCATCCTTACAAATTCAGGATTTAAAAGGAACTAACCGGGATCCTCGTCTGAACAGGATAAGCCAACATTCTCATGGAAAAGATCAGAGTCACAGGAAAGAATTTCTAATGAACACATTAAACCAGTCTGATACTAAGACAAGTAAAACTATACCCTCTGAAAAACTAAATTCATCCAAGCAAGAAAAAAGTAAATCAGGTGAAAAAATAACCAAGAAAGAACTTGACCAATTAGATTCTAAATCGAAATCGAAATCGAAATCACCCTCACCTTTGAAAAACAAATTATCTCACACAAAAGACTTGAAAAATCAAGAATCGGAAAGTATGAGGTTGTCTGATATGAACAAGAGAGATCCAAGATTAAAAAAACATCTTCAGGATAAGACCGATGGCAAAGATGATGATGTGAAAGAGAAGAGAAAAACTGCAGAAAAAAAGGATAAAGATGAGCACATGAAGTCATCCGAACACAGACTGGCTGGAAGTAGAAATAAAATCATAAATGGCATTGTACAAAAACAGGATACAATAACAGAAGAGTCAGAAAAACAGGGGACAAAACCAGGGAGATCGAGTACTAGAAAGCGATCAAGATCTCGATCACCCAAGTCTAGGTCACCAATTATACATTCCCCAAAGAGAAGAGATAGGCGGTCACCCAAACGAAGGCAAAGAAGTATGTCTCCAACATCGACACCTAAAGCTGGAAAGATTCGCCAATCTGGAGCTAAGCAGTCACATATGGAAGAGTTTACACCACCTTCTAGGGAAGACAGAAATGCTAAGAGAAGTACTAAACAGGATATTCGGGATCCAAGGCGAATGAAAAAGACTGAAGAGGAGCGACCACAAGAAACTACAAATCAGCATTCTACAAAGTCAGGCACTGAACCAAAGGAGAATGTAGAAAACTGGCAAAGTTCCAAGTCTGCCAAAAGATGGAAATCTGGTTGGGAAGAAAATAAAAGCTTACAACAGGTTGATGAACATAGTAAACCTCCTCATCTGAGGCATAGGGAGAGCTGGTCAAGCACTAAAGGAATTTTATCACCTCGAGCCCCAAAGCAGCAACAGCATCGATTAAGTGTAGATGCCAATCTTCAGATTCCTAAAGAGTTAACTCTTGCAAGCAAAAGAGAATTACTTCAAAAGACGAGTGAACGTTTAGCATCTGGTGAAATTACACAGGATGACTTCCTTGTTGTTGTGCATCAAATTCGACAGCTATTTCAGTATCAAGAAGGTGTGCGAGAAGAGCAGAGATCTCCATTCAATGATCGTTTTCCACTTAAGCGACCTCGATATGAAGATTCAGATAAACCATTTGTAGATAGTCCAGCATCAAGATTCGCCGGCCTGGATACAAATCAGCGACTTACAGCTTTAGCTGAAGACAGACCGTTATTTGATGGACCTAGTAGGCCATCAGTAGCAAGAGATGGCCCAACGAAGATGATTTTTGAAGGACCCAATAAATTAAGCCCTCGAATTGATGGACCTCCCACACCAGCTTCTCTTCGGTTTGATGGGTCACCAGGACAAATGGGGGGAGGAGGCCCTTTGAGATTTGAGGGGCCACAAGGTCAGCTAGGAGGTGGGTGTCCTTTGAGATTTGAAGGTCCTCCAGGACCAGTGGGGACACCTCTGCGGTTTGAGGGCCCAATTGGTCAAGCAGGAGGAGGTGGTTTTCGGTTTGAAGGTTCCCCTGGTCTGAGGTTTGAGGGATCTCCAGGTGGTTTGAGATTTGAGGGACCAGGAGGCCAGCCTGTGGGTGGTCTGAGGTTTGAGGGACATCGTGGTCAACCTGTGGGTGGTCTAAGGTTTGAGGGACCTCATGGTCAGCCTGTGGGTGGACTTAGATTTGATAATCCCCGAGGTCAGCCTGTAGGTGGACTTAGATTTGAGGGGGGTCATGGTCCATCAGGGGCTGCGATTAGGTTTGATGGACCTCATGGTCAGCCAGGAGGTGGAATCAGATTTGAGGGCCCTTTGCTACAGCAAGGGGTTGGAATGAGGTTTGAGGGCCCCCATGGTCAGTCAGTAGCTGGTCTGAGATTTGAGGGACAACATAATCAACTTGGTGGGAACCTTAGGTTTGAGGGTCCACATGGTCAGCCAGGGGTTGGTATCAGGTTTGAAGGCCCTTTAGTCCAACAAGGAGGTGGAATGAGGTTTGAGGGTCCTTCTGTACCAGGAGGTGGCCTGAGAATTGAAGGGCCTCTGGGTCAAGGTGGTCCAAGATTTGAAGGTTGTCATGCTTTAAGGTTTGATGGGCAGCCAGGTCAGCCGTCACTCTTGCCAAGATTTGATGGATTACATGGTCAGCCAGGTCCTAGATTTGAAAGGACTCCTGGTCAGCCAGGCCCTCAGAGGTTTGATGGACCACCTGGACAGCAGGTTCAACCCAGATTTGACGGTGTACCTCAAAGATTTGATGGTCCACAACATCAGCAAGCATCAAGGTTTGATATTCCTCTTGGTCTTCAAGGCACAAGATTTGACAATCATCCTTCACAAAGGCTTGAATCAGTATCTTTCAATCAGACTGGTCCATATAATGATCCACCTGGCAATGCTTTTAATGCCCCATCCCAAGGACTACAGTTCCAAAGACATGAACAAATATTTGATTCACCTCAAGGACCAAATTTTAATGGACCACATGGCCCTGGAAACCAGAGTTTCTCTAATCCACTTAACAGAGCTTCTGGACACTATTTTGATGAAAAAAATCTTCAGAGTTCTCAATTTGGAAACTTTGGCAATATACCTGCTCCAATGACAGTAGGAAATATTCAGGCATCTCAACAGGTTCTGAGTGGTGTTGCTCAGCCAGTAGCTTTTGGTCAAGGACAACAGTTTTTACCAGTTCATCCACAAAATCCTGGATTTGTTCAGAATCCTTCAGGAGCCCTCCCTAAGGCATATCCTGATAATCATCTCAGTCAGGTGGATGTAAATGAATTGTTTTCAAAATTGCTAAAAACAGGAATTCTCAAATTGTCCCAAACTGATTCAGCTACAACACAAGTAAGTGAAGTAACTGCTCAGCCTCCCCCTGAAGAGGAGGAAGATCAAAATGAAGATCAAGATGTTCCAGATCTTACTAATTTTACAGTTGAAGAATTGAAACAACGTTATGACAGTGTTATAAATCGACTGTACACTGGTATTCAGTGTTACTCTTGTGGAATGAGGTTTACAACATCACAGACAGATGTTTATGCAGATCATTTGGACTGGCATTATCGGCAAAATAGAACTGAAAAGGATGTTAGCCGAAAAGTCACTCATAGACGTTGGTACTACAGTTTAACAGACTGGATAGAATTTGAGGAGATAGCTGATCTGGAAGAACGGGCAAAGAGCCAGTTTTTTGAAAAGGTGCATGAAGAAGTTGTGCTCAAAACTCAAGAGGCTGCTAAAGAAAAAGAGTTCCAAAGTGTACCTGCTGGACCAGCTGGAGCAGTTGAGAGTTGTGAAATCTGTCAAGAACAATTTGAACAATACTGGGATGAAGAAGAGGAGGAATGGCATTTGAAAAATGCTATTAGAGTAGATGGAAAGATTTATCATCCATCATGTTATGAAGATTATCAAAATACATCTTCATTTGATTGTACACCATCTCCCAGCAAGACACCAGTTGAAAACCCCTTGAATATTATGTTGAACATTGTCAAAAACGAATTGCAGGAACCCTGTGACAGTCCCAAAGTTAAGGAAGAACGAATTGATACACCACCAGCTTGTACAGAGGAAAGCATAGCAACACCCTCTGAAATTAAAACAGAAAATGACACAGTCGAGTCAGTTTAA

  • Gene name: PCF11
  • Gene ID: 51585
  • Accession number: BC065384
  • Vector: pUC
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing. For research use only.
Contact Form

Ако желаете да получите оферта или имате въпроси за този продукт, моля копирайте линка или каталожния номер когато изпращате запитване.
Ако имате някакви въпроси, моля да се свържете с Гентауър.
За да се срържете с нас:
Телефон: +359 89 745 53 88
Имейл: [email protected]

Related Products:

Id Title / Description Supplier Size Price
20-abx959844

Human PCF11 shRNA Plasmid

Abbexa 150 µg, 300 µg 1602 BGN, 2242 BGN
1-CSB-PA017603LA01HU

PCF11 Antibody

Cusabio 100ug, 50ug 634 BGN, 670 BGN
CSB-CL890768HU-10ug

PSMD13 cloning plasmid

Cusabio 10ug 466 BGN
CSB-CL890769HU-10ug

ST3GAL5 cloning plasmid

Cusabio 10ug 466 BGN
CSB-CL891543HU-10ug

PADI1 cloning plasmid

Cusabio 10ug 752 BGN