CSB-CL017606HU-10ug

PCGF2 cloning plasmid

466 BGN
Размер: 10ug
Oписание: A cloning plasmid for the PCGF2 gene.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atgcatcggactacacggatcaaaatcacagagctgaacccccacctcatgtgtgccctctgcggggggtacttcatcgacgccaccactatcgtggagtgcctgcattccttctgcaaaacctgcatcgtgcgctacctggagaccaacaaatactgccccatgtgtgacgtgcaggtccataaaacccggccgctgctgagcatcaggtctgacaaaacacttcaagacattgtctacaaattggtccctgggctttttaaagatgagatgaaacggcggcgggatttctatgcagcgtaccccctgacggaggtccccaacggctccaatgaggaccgcggcgaggtcttggagcaggagaagggggctctgagtgatgatgagattgtcagcctctccatcgaattctacgaaggtgccagggaccgggacgagaagaagggccccctggagaatggggatggggacaaagagaaaacaggggtgcgcttcctgcgatgcccagcagccatgaccgtcatgcatcttgccaagtttctccgcaacaagatggatgtgcccagcaagtacaaggtggaggttctgtacgaggacgagccactgaaggaatactacaccctcatggacatcgcctacatctacccctggcggcggaacgggcctctccccctcaagtaccgtgtccagccagcctgcaagcggctcaccctagccacggtgcccaccccctccgagggcaccaacaccagcggggcgtccgagtgtgagtcagtcagcgacaaggctcccagccctgccaccctgccagccacctcctcctccctgcccagcccagccaccccatcccatggctctcccagttcccatgggcctccagccacccaccctacctcccccactcccccttcgacagccagtggggccaccacagctgccaacgggggtagcttgaactgcctgcagacaccatcctccaccagcagggggcgcaagatgactgtcaacggcgctcccgtgccccccttaacttga

  • Gene name: PCGF2
  • Gene ID: 7703
  • Accession number: BC004858
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing. For research use only.
Contact Form

Ако желаете да получите оферта или имате въпроси за този продукт, моля копирайте линка или каталожния номер когато изпращате запитване.
Ако имате някакви въпроси, моля да се свържете с Гентауър.
За да се срържете с нас:
Телефон: +359 89 745 53 88
Имейл: [email protected]

Related Products:

Id Title / Description Supplier Size Price
PVTB00139

pOTB7-pcgf2 Plasmid

Lifescience Market 2 ug 712 BGN
20-abx973445

Mouse PCGF2 shRNA Plasmid

Abbexa 150 µg, 300 µg 1602 BGN, 2242 BGN
CSB-CL890767HU-10ug

DUSP12 cloning plasmid

Cusabio 10ug 466 BGN
CSB-CL890768HU-10ug

PSMD13 cloning plasmid

Cusabio 10ug 466 BGN
CSB-CL891540HU-10ug

ELF5 cloning plasmid

Cusabio 10ug 466 BGN