CSB-CL017794HU1-10ug

PEX10 cloning plasmid

768 BGN
Размер: 10ug
Oписание: A cloning plasmid for the PEX10 gene.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttggcctcaccacacttgcaggctaccagaccctgggggaggagtacgtcagcatcatccaggtggacccatcgcggatacatgtgccctcctcgctgcgccgtggcgtgctggtgacactgcatgccgtcctgccctacctgctggacaaggccctgctccccctggagcaggagctgcaggctgaccccgacagtgggcgacccttgcaggggagcctggggccaggtgggcgtggctgctcaggggcgcggcgctggatgcgtcaccacacggccaccctgactgagcagcagaggagggcgctgctgcgggcggtcttcgtcctcagacagggcctcgcctgcctccagcggctacatgttgcctggttttacatccacggtgtcttctaccacctggccaagaggctcacggggatcacgtacctccgtgtccgcagcctgcccggagaggacctgagggcccgtgttagctacaggctgctgggggtcatctcactgctgcacctggtgctgtccatggggctgcagctgtacggtttcaggcagcggcagcgagccaggaaggagtggaggctgcaccgcggcctgtctcaccgcagggcctccttggaggagagagccgtttccagaaaccccctgtgcaccctgtgcctggaggagcgcaggcacccaacagccacgccctgcggccacctgttctgctgggagtgcatcaccgcgtggtgcagcagcaaggcggagtgtcccctctgccgggagaagttccctccccagaagctcatctaccttcggcactaccgctga

  • Gene name: PEX10
  • Gene ID: 5192
  • Accession number: BC018198
  • Vector: pUC
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing. For research use only.
Contact Form

Ако желаете да получите оферта или имате въпроси за този продукт, моля копирайте линка или каталожния номер когато изпращате запитване.
Ако имате някакви въпроси, моля да се свържете с Гентауър.
За да се срържете с нас:
Телефон: +359 89 745 53 88
Имейл: [email protected]

Related Products:

Id Title / Description Supplier Size Price
CSB-CL017794HU2-10ug

PEX10 cloning plasmid

Cusabio 10ug 466 BGN
20-abx984255

Mouse PEX10 shRNA Plasmid

Abbexa 150 µg, 300 µg 1602 BGN, 2242 BGN
CSB-CL890755HU-10ug

FZD4 cloning plasmid

Cusabio 10ug 1124 BGN
CSB-CL890756HU-10ug

STAP1 cloning plasmid

Cusabio 10ug 466 BGN
CSB-CL891526HU-10ug

HOOK1 cloning plasmid

Cusabio 10ug 948 BGN