SNX6 cloning plasmid

SKU: 2234567821 Категории:

466.00BGN

  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atgacgaaggaagaattcacaaagatgaaacaggaactggaagctgaatatttggcaatattcaagaagacagttgcgatgcatgaagtgttcctgtgtcgtgtggcagcacatcctattttgagaagagatttaaatttccatgtcttcttggaatataatcaagatttgagtgtgcgaggaaaaaataaaaaagagaaacttgaagacttctttaaaaacatggttaaatcagcagatggagtaatcgtttcaggagtaaaggatgtagatgatttctttgagcacgaacgaacatttcttttggaatatcataaccgagttaaggatgcatctgctaaatctgatagaatgacaagatcccacaaaagtgctgcagatgattacaatagaattggttcttcattatatgctttaggaactcaggattctacagatatatgcaagttttttctcaaagtttcagaactgttcgataaaacaagaaaaatagaagcacgagtgtctgctgatgaagacctcaaactttctgatcttttaaaatattacttaagagaatctcaagctgctaaggatctcctgtatcgaaggtctaggtcactagtggattatgaaaatgctaataaagcactggataaagcaagagcaaaaaataaagatgttctacaggccgaaacttcccaacaattatgttgtcagaaatttgaaaaaatatctgagtctgcaaaacaagaacttatagattttaagacaagaagagttgctgcattcagaaaaaatttagtggaactggcagagttagaactgaagcatgcaaagggtaatctacagttgctgcagaactgcctggcagtgttaaatggagacacataa


Description

A cloning plasmid for the SNX6 gene.

Contact Form

    Ако желаете да получите оферта или имате въпроси за този продукт, моля копирайте линка или каталожния номер когато изпращате запитване.
    Ако имате някакви въпроси, моля да се свържете с Гентауър.
    За да се срържете с нас:
    Телефон: +359 89 745 53 88
    Имейл: [email protected]

    Related Products:

    Id Title / Description Supplier Size Price
    20-abx977708

    Mouse SNX6 shRNA Plasmid

    Abbexa 150 µg, 300 µg 1602.00 BGN, 2242.00 BGN
    20-abx961751

    Human SNX6 shRNA Plasmid

    Abbexa 150 µg, 300 µg 1602.00 BGN, 2242.00 BGN
    CSB-CL890782HU-10ug

    CLCA2 cloning plasmid

    Cusabio 10ug 1804.00 BGN
    CSB-CL890907HU1-10ug

    MCM8 cloning plasmid

    Cusabio 10ug 1116.00 BGN
    CSB-CL891553HU-10ug

    CLEC4E cloning plasmid

    Cusabio 10ug 466.00 BGN
    HomeCategoriesWishlistAccount
    Search
    1