SNX7 cloning plasmid

SKU: 2234567821 Категории:

466.00BGN

  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1011
  • Sequence: atggacatgaactccttcagccctatgatgccaacatcccctttatcaatgataaaccaaatcaagtttgaggatgaaccagatttaaaggatctcttcatcacagttgatgaacctgaaagtcatgttactacaatagaaactttcattacgtataggattattactaagacatctcgtggggaatttgactccagtgaatttgaagttaggagacgatatcaagatttcctttggttgaagggaaaactggaagaagcacaccccactctgattattccaccattgccagaaaagtttatagtaaaaggaatggtggaacgctttaacgatgacttcattgagacacgcaggaaggctttacataaatttttgaaccgaattgctgatcatccaactttaacatttaatgaagacttcaaaatttttctcactgcacaagcttgggaactctcttctcacaagaagcaaggtcctggcttgctaagcaggatggggcaaaccgtcagagctgttgcgtcctcaatgagaggagttaaaaaccgcccagaggagttcatggaaatgaataactttattgaactatttagccagaaaataaatttgatagataaaatatctcagagaatttataaggaagaaagggaatattttgatgaaatgaaagaatatggcccaattcatattctgtggtcagcgtcagaagaggatctggttgatactctaaaggatgttgccagctgcattgacagatgctgtaaggccactgaaaagcggatgtctggactctcagaggccctgcttcctgttgtacatgagtacgtgctttatagtgaaatgttaatgggtgttatgaaaagaagagaccaaatacaagcagaactggattccaaagttgaagttttgacctataaaaaggcagatactgatctgtgccttgctacgtgggaatcattccttacatcacagaccaaccttcacttggaagaagcctctgaagataaaccttaa


Description

A cloning plasmid for the SNX7 gene.

Contact Form

    Ако желаете да получите оферта или имате въпроси за този продукт, моля копирайте линка или каталожния номер когато изпращате запитване.
    Ако имате някакви въпроси, моля да се свържете с Гентауър.
    За да се срържете с нас:
    Телефон: +359 89 745 53 88
    Имейл: [email protected]

    Related Products:

    Id Title / Description Supplier Size Price
    CSB-CL891565HU1-10ug

    SNX7 cloning plasmid

    Cusabio 10ug 466.00 BGN
    20-abx959732

    Human SNX7 shRNA Plasmid

    Abbexa 150 µg, 300 µg 1602.00 BGN, 2242.00 BGN
    CSB-CL890771HU-10ug

    COG5 cloning plasmid

    Cusabio 10ug 1602.00 BGN
    CSB-CL890772HU-10ug

    AP4E1 cloning plasmid

    Cusabio 10ug 2496.00 BGN
    CSB-CL891544HU2-10ug

    INTU cloning plasmid

    Cusabio 10ug 1116.00 BGN
    HomeCategoriesWishlistAccount
    Search
    1