
ST3GAL5 cloning plasmid

466 BGN
Размер: 10ug
Oписание: A cloning plasmid for the ST3GAL5 gene.
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgccaagtgagtacacctatgtgaaactgagaagtgattgctcgaggccttccctgcaatggtacacccgagctcaaagcaagatgagaaggcccagcttgttattaaaagacatcctcaaatgtacattgcttgtgtttggagtgtggatcctttatatcctcaagttaaattatactactgaagaatgtgacatgaaaaaaatgcattatgtggaccctgaccgtgtaaagagagctcagaaatatgctcagcaagtcttgcagaaggaatgtcgtcccaagtttgccaagacatcaatggcgctgttatttgagcacaggtatagcgtggacttactcccttttgtgcagaaggcccccaaagacagtgaagctgagtccaagtacgatcctccttttgggttccggaagttctccagtaaagtccagaccctcttggaactcttgccagagcacgacctccctgaacacttgaaagccaagacctgtcggcgctgtgtggttattggaagcggaggaatactgcacggattagaactgggccacaccctgaaccagttcgatgttgtgataaggttaaacagtgcaccagttgagggatattcagaacatgttggaaataaaactactataaggatgacttatccagagggcgcaccactgtctgaccttgaatattattccaatgacttatttgttgctgttttatttaagagtgttgatttcaactggcttcaagcaatggtaaaaaaggaaaccctgccattctgggtacgactcttcttttggaagcaggtggcagaaaaaatcccactgcagccaaaacatttcaggattttgaatccagttatcatcaaagagactgcctttgacatccttcagtactcagagcctcagtcaaggttctggggccgagataagaacgtccccacaatcggtgtcattgccgttgtcttagccacacatctgtgcgatgaagtcagtttggcgggttttggatatgacctcaatcaacccagaacacctttgcactacttcgacagtcaatgcatggctgctatgaactttcagaccatgcataatgtgacaacggaaaccaagttcctcttaaagctggtcaaagagggagtggtgaaagatctcagtggaggcattgatcgtgaattttga

  • Gene name: ST3GAL5
  • Gene ID: 8869
  • Accession number: BC065936
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing. For research use only.
Contact Form

Ако желаете да получите оферта или имате въпроси за този продукт, моля копирайте линка или каталожния номер когато изпращате запитване.
Ако имате някакви въпроси, моля да се свържете с Гентауър.
За да се срържете с нас:
Телефон: +359 89 745 53 88
Имейл: [email protected]

Related Products:

Id Title / Description Supplier Size Price

Mouse ST3GAL5 shRNA Plasmid

Abbexa 150 µg, 300 µg 1602 BGN, 2242 BGN

Rat ST3GAL5 shRNA Plasmid

Abbexa 150 µg, 300 µg 1602 BGN, 2242 BGN

PACSIN2 cloning plasmid

Cusabio 10ug 466 BGN

SNX6 cloning plasmid

Cusabio 10ug 466 BGN

ANGPTL2 cloning plasmid

Cusabio 10ug 1048 BGN